|
Data File: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\oligo05.raw Sample ID: test oligo 05 Position: 5 Processing Method: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\HT_oligo Nucleotide: 1--------10--------20--------30--------40--------50 TATTTAATATAATTACAGAACACATTGGTCG Termini: H, OH Average Mass (Da): 9516.3 Monoisotopic Mass (Da): 9511.6 |
|
| RT (min) | Target Mass (Da) | Observed Mass (Da) | Mass Error | Intensity | % Total Abundance |
Identity | Result Code |
|---|---|---|---|---|---|---|---|
| 0.35 | 9516.3 | 9515.1 | -1.2 Da (-0.013 %) | 2.86E+005 | 38.7 | Target Mass | P |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality | LC/MS Peak Area | LC/MS Area Percent |
|---|---|---|---|---|---|
| 0.35 | 9515.1 | 2.86E+005 | ok | 2.02E+007 | 100.00 |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test oligo 05:
TIC
[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test oligo 05:
[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
ESI Mass Spectrum of test oligo 05, RT = 0.35 min:
Scan Mode: - c Full ms
Scans Averaged: 10-12 Minus: 6-7, 17-18
[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Deconvoluted Mass Spectrum of test oligo 05, RT = 0.35 min:
[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 05, RT = 0.35 min:
| Mass (Da) | Intensity | Delta Mass |
%Relative | %Total | Presumed Identity |
|---|---|---|---|---|---|
| 9515.1 | 2.86E+005 | 0.0 | 100.0 | 38.7 | Target Mass: 9516.3 |
| 9380.3 | 1.19E+005 | -134.8 | 41.7 | 16.2 | 9516.3 (A depurination) |
| 4254.8 | 2.66E+004 | -5260.3 | 9.3 | 3.6 | ? |
| 9551.6 | 2.22E+004 | 36.5 | 7.8 | 3.0 | 9516.3 (*K adduct) |
| 4777.5 | 2.01E+004 | -4737.6 | 7.1 | 2.7 | ? |
| 9571.6 | 1.80E+004 | 56.5 | 6.3 | 2.4 | 9516.3 (Plus DMF) |
| 4649.0 | 1.67E+004 | -4866.1 | 5.8 | 2.3 | ? |
| 8280.1 | 1.45E+004 | -1235.0 | 5.1 | 2.0 | ? |
| 6617.6 | 1.34E+004 | -2897.5 | 4.7 | 1.8 | ? |
| 5569.2 | 1.26E+004 | -3945.9 | 4.4 | 1.7 | ? |
| 9612.5 | 1.24E+004 | 97.4 | 4.3 | 1.7 | ? |
| 2768.2 | 1.21E+004 | -6746.9 | 4.2 | 1.6 | ? |
| 4120.0 | 1.15E+004 | -5395.1 | 4.0 | 1.6 | ? |
| 11289.2 | 1.13E+004 | 1774.1 | 3.9 | 1.5 | ? |
| 10930.3 | 1.10E+004 | 1415.2 | 3.9 | 1.5 | ? |
| 9398.9 | 9.88E+003 | -116.2 | 3.5 | 1.3 | ? |
| 9137.2 | 8.28E+003 | -377.9 | 2.9 | 1.1 | ? |
| 1855.0 | 7.63E+003 | -7660.1 | 2.7 | 1.0 | ? |
| 10541.5 | 7.16E+003 | 1026.4 | 2.5 | 1.0 | ? |
| 10490.9 | 6.94E+003 | 975.8 | 2.4 | 0.9 | ? |
| 9421.4 | 6.85E+003 | -93.7 | 2.4 | 0.9 | ? |
| 10088.2 | 6.45E+003 | 573.1 | 2.3 | 0.9 | ? |
| 9248.4 | 6.13E+003 | -266.7 | 2.1 | 0.8 | ? |
| 11096.1 | 6.07E+003 | 1581.0 | 2.1 | 0.8 | ? |
| 6345.3 | 5.96E+003 | -3169.8 | 2.1 | 0.8 | ? |
| 4568.6 | 5.70E+003 | -4946.5 | 2.0 | 0.8 | ? |
| 3370.5 | 5.23E+003 | -6144.6 | 1.8 | 0.7 | ? |
| 11257.2 | 4.39E+003 | 1742.1 | 1.5 | 0.6 | ? |
| 4704.3 | 4.18E+003 | -4810.8 | 1.5 | 0.6 | ? |
| 5436.4 | 4.17E+003 | -4078.7 | 1.5 | 0.6 | ? |
| 4445.2 | 4.09E+003 | -5069.9 | 1.4 | 0.6 | ? |
| 6093.6 | 3.99E+003 | -3421.5 | 1.4 | 0.5 | ? |
| 4966.4 | 3.91E+003 | -4548.7 | 1.4 | 0.5 | ? |
| 10292.0 | 3.90E+003 | 776.9 | 1.4 | 0.5 | ? |
| 5138.5 | 3.81E+003 | -4376.6 | 1.3 | 0.5 | ? |
| 3718.1 | 3.72E+003 | -5797.0 | 1.3 | 0.5 | ? |
| 9068.8 | 3.38E+003 | -446.3 | 1.2 | 0.5 | ? |
| 6365.2 | 3.12E+003 | -3149.9 | 1.1 | 0.4 | ? |
| 6263.8 | 3.11E+003 | -3251.3 | 1.1 | 0.4 | ? |
| 2482.0 | 3.09E+003 | -7033.1 | 1.1 | 0.4 | ? |
| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |