|
Data File: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\oligo07.raw Sample ID: test oligo 07 Position: 7 Processing Method: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\HT_oligo Nucleotide: 1--------10--------20--------30--------40--------50 TGGCTCAGGCAAACAGAGACT Termini: H, OH Average Mass (Da): 6464.3 Monoisotopic Mass (Da): 6461.1 |
|
| RT (min) | Target Mass (Da) | Observed Mass (Da) | Mass Error | Intensity | % Total Abundance |
Identity | Result Code |
|---|---|---|---|---|---|---|---|
| 0.32 | 6464.3 | 6464.7 | 0.4 Da (0.006 %) | 6.04E+005 | 69.7 | Target Mass | G |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality | LC/MS Peak Area | LC/MS Area Percent |
|---|---|---|---|---|---|
| 0.32 | 6464.7 | 6.04E+005 | ok | 1.81E+007 | 100.00 |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test oligo 07:
TIC
[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test oligo 07:
[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
ESI Mass Spectrum of test oligo 07, RT = 0.32 min:
Scan Mode: - c Full ms
Scans Averaged: 9-11 Minus: 5-6, 16-17
[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Deconvoluted Mass Spectrum of test oligo 07, RT = 0.32 min:
[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 07, RT = 0.32 min:
| Mass (Da) | Intensity | Delta Mass |
%Relative | %Total | Presumed Identity |
|---|---|---|---|---|---|
| 6464.7 | 6.04E+005 | 0.0 | 100.0 | 69.7 | Target Mass: 6464.3 |
| 6328.6 | 8.21E+004 | -136.1 | 13.6 | 9.5 | 6464.3 (A depurination) |
| 6499.8 | 3.40E+004 | 35.1 | 5.6 | 3.9 | 6464.3 (*K adduct) |
| 7908.4 | 2.95E+004 | 1443.7 | 4.9 | 3.4 | ? |
| 6352.7 | 2.34E+004 | -112.0 | 3.9 | 2.7 | 6464.3 (C depyrimidination) |
| 6312.4 | 2.21E+004 | -152.3 | 3.7 | 2.6 | 6464.3 (G depurination) |
| 6151.5 | 1.93E+004 | -313.2 | 3.2 | 2.2 | 6464.3 (Minus A) |
| 5836.6 | 1.29E+004 | -628.1 | 2.1 | 1.5 | ? |
| 6518.0 | 1.12E+004 | 53.3 | 1.8 | 1.3 | 6464.3 (Plus DMF) |
| 5526.5 | 8.17E+003 | -938.2 | 1.4 | 0.9 | ? |
| 3420.0 | 6.76E+003 | -3044.7 | 1.1 | 0.8 | ? |
| 6479.0 | 6.70E+003 | 14.3 | 1.1 | 0.8 | ? |
| 2447.5 | 6.37E+003 | -4017.2 | 1.1 | 0.7 | ? |
| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |