|
Data File: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\oligo08.raw Sample ID: test oligo 08 Position: 8 Processing Method: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\HT_oligo Nucleotide: 1--------10--------20--------30--------40--------50 TTCGGACAAAAAGGATACGATTAACA Termini: H, OH Average Mass (Da): 8020.3 Monoisotopic Mass (Da): 8016.4 |
|
| RT (min) | Target Mass (Da) | Observed Mass (Da) | Mass Error | Intensity | % Total Abundance |
Identity | Result Code |
|---|---|---|---|---|---|---|---|
| 0.32 | 8020.3 | 8021.1 | 0.8 Da (0.010 %) | 6.46E+005 | 61.0 | Target Mass | G |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality | LC/MS Peak Area | LC/MS Area Percent |
|---|---|---|---|---|---|
| 0.32 | 8021.1 | 6.46E+005 | ok | 2.47E+007 | 100.00 |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test oligo 08:
TIC
[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test oligo 08:
[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
ESI Mass Spectrum of test oligo 08, RT = 0.32 min:
Scan Mode: - c Full ms
Scans Averaged: 9-11 Minus: 5-6, 16-17
[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Deconvoluted Mass Spectrum of test oligo 08, RT = 0.32 min:
[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 08, RT = 0.32 min:
| Mass (Da) | Intensity | Delta Mass |
%Relative | %Total | Presumed Identity |
|---|---|---|---|---|---|
| 8021.1 | 6.46E+005 | 0.0 | 100.0 | 61.0 | Target Mass: 8020.3 |
| 7884.0 | 1.17E+005 | -137.1 | 18.2 | 11.1 | 8020.3 (A depurination) |
| 7706.0 | 8.57E+004 | -315.1 | 13.3 | 8.1 | 8020.3 (Minus A) |
| 5289.8 | 2.95E+004 | -2731.3 | 4.6 | 2.8 | ? |
| 8056.9 | 2.52E+004 | 35.8 | 3.9 | 2.4 | 8020.3 (*K adduct) |
| 8039.8 | 2.44E+004 | 18.7 | 3.8 | 2.3 | 8020.3 (*Na adduct) |
| 4247.2 | 1.97E+004 | -3773.9 | 3.0 | 1.9 | ? |
| 6173.7 | 1.74E+004 | -1847.4 | 2.7 | 1.6 | ? |
| 3092.1 | 1.25E+004 | -4929.0 | 1.9 | 1.2 | ? |
| 3324.9 | 1.11E+004 | -4696.2 | 1.7 | 1.1 | ? |
| 8651.5 | 1.06E+004 | 630.4 | 1.6 | 1.0 | ? |
| 9531.1 | 1.05E+004 | 1510.0 | 1.6 | 1.0 | ? |
| 6797.9 | 1.05E+004 | -1223.2 | 1.6 | 1.0 | ? |
| 6458.6 | 1.00E+004 | -1562.5 | 1.5 | 0.9 | ? |
| 9665.7 | 7.75E+003 | 1644.6 | 1.2 | 0.7 | ? |
| 6020.6 | 6.93E+003 | -2000.5 | 1.1 | 0.7 | ? |
| 7299.8 | 6.90E+003 | -721.3 | 1.1 | 0.7 | ? |
| 7390.9 | 6.78E+003 | -630.2 | 1.0 | 0.6 | ? |
| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |