|
Data File: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\oligo09.raw Sample ID: test oligo 09 Position: 9 Processing Method: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\HT_oligo Nucleotide: 1--------10--------20--------30--------40--------50 TGAGTATAGTCATTGTTGATGTGTATGTAG Termini: H, OH Average Mass (Da): 9337.1 Monoisotopic Mass (Da): 9332.6 |
|
| RT (min) | Target Mass (Da) | Observed Mass (Da) | Mass Error | Intensity | % Total Abundance |
Identity | Result Code |
|---|---|---|---|---|---|---|---|
| 0.32 | 9337.1 | 9337.5 | 0.4 Da (0.004 %) | 4.08E+005 | 50.1 | Target Mass | G |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality | LC/MS Peak Area | LC/MS Area Percent |
|---|---|---|---|---|---|
| 0.32 | 9337.5 | 4.08E+005 | ok | 1.96E+007 | 100.00 |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test oligo 09:
TIC
[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test oligo 09:
[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
ESI Mass Spectrum of test oligo 09, RT = 0.32 min:
Scan Mode: - c Full ms
Scans Averaged: 9-11 Minus: 5-6, 16-17
[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Deconvoluted Mass Spectrum of test oligo 09, RT = 0.32 min:
[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 09, RT = 0.32 min:
| Mass (Da) | Intensity | Delta Mass |
%Relative | %Total | Presumed Identity |
|---|---|---|---|---|---|
| 9337.5 | 4.08E+005 | 0.0 | 100.0 | 50.1 | Target Mass: 9337.1 |
| 9201.4 | 9.63E+004 | -136.1 | 23.6 | 11.8 | 9337.1 (A depurination) |
| 4591.2 | 3.01E+004 | -4746.3 | 7.4 | 3.7 | ? |
| 9374.0 | 3.00E+004 | 36.5 | 7.3 | 3.7 | 9337.1 (*K adduct) |
| 7484.3 | 2.24E+004 | -1853.2 | 5.5 | 2.7 | ? |
| 5294.1 | 1.93E+004 | -4043.4 | 4.7 | 2.4 | ? |
| 9359.9 | 1.92E+004 | 22.4 | 4.7 | 2.4 | 9337.1 (*Na adduct) |
| 11081.9 | 1.68E+004 | 1744.4 | 4.1 | 2.1 | ? |
| 3608.7 | 1.60E+004 | -5728.8 | 3.9 | 2.0 | ? |
| 8165.3 | 1.51E+004 | -1172.2 | 3.7 | 1.8 | ? |
| 9976.2 | 1.22E+004 | 638.7 | 3.0 | 1.5 | ? |
| 5239.3 | 1.17E+004 | -4098.2 | 2.9 | 1.4 | ? |
| 5535.8 | 1.14E+004 | -3801.7 | 2.8 | 1.4 | ? |
| 11042.0 | 9.09E+003 | 1704.5 | 2.2 | 1.1 | ? |
| 4270.7 | 8.95E+003 | -5066.8 | 2.2 | 1.1 | ? |
| 7599.2 | 8.54E+003 | -1738.3 | 2.1 | 1.0 | ? |
| 5747.4 | 7.93E+003 | -3590.1 | 1.9 | 1.0 | ? |
| 8318.1 | 7.63E+003 | -1019.4 | 1.9 | 0.9 | ? |
| 8397.7 | 6.78E+003 | -939.8 | 1.7 | 0.8 | ? |
| 10600.2 | 6.67E+003 | 1262.7 | 1.6 | 0.8 | ? |
| 2519.1 | 6.28E+003 | -6818.4 | 1.5 | 0.8 | ? |
| 6178.9 | 6.16E+003 | -3158.6 | 1.5 | 0.8 | ? |
| 9239.1 | 5.85E+003 | -98.4 | 1.4 | 0.7 | ? |
| 9392.3 | 5.62E+003 | 54.8 | 1.4 | 0.7 | 9337.1 (Plus DMF) |
| 9898.6 | 5.08E+003 | 561.1 | 1.2 | 0.6 | ? |
| 11123.4 | 4.84E+003 | 1785.9 | 1.2 | 0.6 | ? |
| 4437.6 | 4.75E+003 | -4899.9 | 1.2 | 0.6 | ? |
| 2048.8 | 4.31E+003 | -7288.7 | 1.1 | 0.5 | ? |
| 3345.8 | 4.23E+003 | -5991.7 | 1.0 | 0.5 | ? |
| 4479.1 | 4.18E+003 | -4858.4 | 1.0 | 0.5 | ? |
| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |