|
Data File: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\oligo11.raw Sample ID: test oligo 11 Position: 11 Processing Method: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\HT_oligo Nucleotide: 1--------10--------20--------30--------40--------50 TCCCCGGTAGTATTGCCAAGCCAAA Termini: H, OH Average Mass (Da): 7611.0 Monoisotopic Mass (Da): 7607.3 |
|
| RT (min) | Target Mass (Da) | Observed Mass (Da) | Mass Error | Intensity | % Total Abundance |
Identity | Result Code |
|---|---|---|---|---|---|---|---|
| 0.32 | 7611.0 | 7610.6 | -0.4 Da (-0.005 %) | 4.72E+005 | 60.0 | Target Mass | G |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality | LC/MS Peak Area | LC/MS Area Percent |
|---|---|---|---|---|---|
| 0.32 | 7610.6 | 4.72E+005 | ok | 1.85E+007 | 100.00 |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test oligo 11:
TIC
[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test oligo 11:
[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
ESI Mass Spectrum of test oligo 11, RT = 0.32 min:
Scan Mode: - c Full ms
Scans Averaged: 9-11 Minus: 5-6, 16-17
[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Deconvoluted Mass Spectrum of test oligo 11, RT = 0.32 min:
[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 11, RT = 0.32 min:
| Mass (Da) | Intensity | Delta Mass |
%Relative | %Total | Presumed Identity |
|---|---|---|---|---|---|
| 7610.6 | 4.72E+005 | 0.0 | 100.0 | 60.0 | Target Mass: 7611.0 |
| 7475.7 | 8.78E+004 | -134.9 | 18.6 | 11.2 | 7611.0 (A depurination) |
| 9167.7 | 3.45E+004 | 1557.1 | 7.3 | 4.4 | ? |
| 4585.9 | 3.14E+004 | -3024.7 | 6.7 | 4.0 | ? |
| 8044.5 | 1.96E+004 | 433.9 | 4.2 | 2.5 | ? |
| 3822.5 | 1.69E+004 | -3788.1 | 3.6 | 2.1 | ? |
| 2737.1 | 1.60E+004 | -4873.5 | 3.4 | 2.0 | ? |
| 4319.6 | 1.33E+004 | -3291.0 | 2.8 | 1.7 | ? |
| 7498.1 | 1.28E+004 | -112.5 | 2.7 | 1.6 | 7611.0 (C depyrimidination) |
| 4983.8 | 1.08E+004 | -2626.8 | 2.3 | 1.4 | ? |
| 5632.9 | 1.06E+004 | -1977.7 | 2.3 | 1.4 | ? |
| 5476.0 | 1.05E+004 | -2134.6 | 2.2 | 1.3 | ? |
| 6440.6 | 9.79E+003 | -1170.0 | 2.1 | 1.2 | ? |
| 7647.0 | 8.55E+003 | 36.4 | 1.8 | 1.1 | 7611.0 (*K adduct) |
| 3110.4 | 6.95E+003 | -4500.2 | 1.5 | 0.9 | ? |
| 7631.8 | 6.67E+003 | 21.2 | 1.4 | 0.8 | 7611.0 (*Na adduct) |
| 4790.8 | 6.37E+003 | -2819.8 | 1.3 | 0.8 | ? |
| 6843.3 | 6.28E+003 | -767.3 | 1.3 | 0.8 | ? |
| 7320.7 | 5.88E+003 | -289.9 | 1.2 | 0.7 | 7611.0 (Minus C) |
| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |