|
Data File: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\oligo13.raw Sample ID: test oligo 13 Position: 13 Processing Method: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\HT_oligo Nucleotide: 1--------10--------20--------30--------40--------50 TCTTTTGTTTACTCTCCCCTGTCAG Termini: H, OH Average Mass (Da): 7515.9 Monoisotopic Mass (Da): 7512.2 |
|
| RT (min) | Target Mass (Da) | Observed Mass (Da) | Mass Error | Intensity | % Total Abundance |
Identity | Result Code |
|---|---|---|---|---|---|---|---|
| 0.32 | 7515.9 | 7514.7 | -1.2 Da (-0.016 %) | 8.28E+005 | 79.0 | Target Mass | G |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality | LC/MS Peak Area | LC/MS Area Percent |
|---|---|---|---|---|---|
| 0.32 | 7514.7 | 8.28E+005 | ok | 2.05E+007 | 100.00 |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test oligo 13:
TIC
[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test oligo 13:
[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
ESI Mass Spectrum of test oligo 13, RT = 0.32 min:
Scan Mode: - c Full ms
Scans Averaged: 9-11 Minus: 5-6, 16-17
[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Deconvoluted Mass Spectrum of test oligo 13, RT = 0.32 min:
[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 13, RT = 0.32 min:
| Mass (Da) | Intensity | Delta Mass |
%Relative | %Total | Presumed Identity |
|---|---|---|---|---|---|
| 7514.7 | 8.28E+005 | 0.0 | 100.0 | 79.0 | Target Mass: 7515.9 |
| 7554.0 | 5.97E+004 | 39.3 | 7.2 | 5.7 | 7515.9 (*K adduct) |
| 7404.6 | 5.02E+004 | -110.1 | 6.1 | 4.8 | 7515.9 (C depyrimidination) |
| 9019.5 | 3.07E+004 | 1504.8 | 3.7 | 2.9 | ? |
| 6382.9 | 2.07E+004 | -1131.8 | 2.5 | 2.0 | ? |
| 7474.7 | 1.41E+004 | -40.0 | 1.7 | 1.3 | ? |
| 3681.9 | 1.23E+004 | -3832.8 | 1.5 | 1.2 | ? |
| 6306.2 | 1.23E+004 | -1208.5 | 1.5 | 1.2 | ? |
| 3786.5 | 1.07E+004 | -3728.2 | 1.3 | 1.0 | ? |
| 7380.3 | 9.55E+003 | -134.4 | 1.2 | 0.9 | 7515.9 (A depurination) |
| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |