|
Data File: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\oligo15.raw Sample ID: test oligo 15 Position: 15 Processing Method: C:\Program Files\ProMassXcali\ProMass Example Data\HT_oligo\HT_oligo Nucleotide: 1--------10--------20--------30--------40--------50 ATTTCGTAGGGATTACAGGCTTTTA Termini: H, OH Average Mass (Da): 7702.1 Monoisotopic Mass (Da): 7698.3 |
|
| RT (min) | Target Mass (Da) | Observed Mass (Da) | Mass Error | Intensity | % Total Abundance |
Identity | Result Code |
|---|---|---|---|---|---|---|---|
| 0.32 | 7702.1 | 7701.2 | -0.9 Da (-0.012 %) | 8.01E+005 | 70.7 | Target Mass | G |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality | LC/MS Peak Area | LC/MS Area Percent |
|---|---|---|---|---|---|
| 0.32 | 7701.2 | 8.01E+005 | ok | 2.15E+007 | 100.00 |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test oligo 15:
TIC
[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test oligo 15:
[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
ESI Mass Spectrum of test oligo 15, RT = 0.32 min:
Scan Mode: - c Full ms
Scans Averaged: 9-11 Minus: 5-6, 16-17
[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Deconvoluted Mass Spectrum of test oligo 15, RT = 0.32 min:
[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[View Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 15, RT = 0.32 min:
| Mass (Da) | Intensity | Delta Mass |
%Relative | %Total | Presumed Identity |
|---|---|---|---|---|---|
| 7701.2 | 8.01E+005 | 0.0 | 100.0 | 70.7 | Target Mass: 7702.1 |
| 7565.5 | 8.49E+004 | -135.7 | 10.6 | 7.5 | 7702.1 (A depurination) |
| 4298.9 | 4.09E+004 | -3402.3 | 5.1 | 3.6 | ? |
| 4218.1 | 2.65E+004 | -3483.1 | 3.3 | 2.3 | ? |
| 7550.9 | 2.34E+004 | -150.3 | 2.9 | 2.1 | 7702.1 (G depurination) |
| 7738.6 | 2.07E+004 | 37.4 | 2.6 | 1.8 | 7702.1 (*K adduct) |
| 1222.9 | 1.57E+004 | -6478.3 | 2.0 | 1.4 | ? |
| 4728.7 | 1.47E+004 | -2972.5 | 1.8 | 1.3 | ? |
| 3294.6 | 1.44E+004 | -4406.6 | 1.8 | 1.3 | ? |
| 6640.1 | 1.33E+004 | -1061.1 | 1.7 | 1.2 | ? |
| 7388.9 | 1.07E+004 | -312.3 | 1.3 | 0.9 | 7702.1 (Minus A) |
| 6443.6 | 1.05E+004 | -1257.6 | 1.3 | 0.9 | ? |
| 2774.1 | 1.04E+004 | -4927.1 | 1.3 | 0.9 | ? |
| 4614.2 | 9.89E+003 | -3087.0 | 1.2 | 0.9 | ? |
| 3088.2 | 9.71E+003 | -4613.0 | 1.2 | 0.9 | ? |
| 7721.0 | 9.19E+003 | 19.8 | 1.1 | 0.8 | ? |
| 8406.2 | 8.81E+003 | 705.0 | 1.1 | 0.8 | ? |
| 5389.9 | 8.36E+003 | -2311.3 | 1.0 | 0.7 | ? |
| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |