oligo07.html

[<<]

Data File: C:\Documents and Settings\Administrator\Desktop\ProMass Example Data\HT_oligo\oligo07.raw
Sample ID: test oligo 07
Nucleotide:
1--------10--------20--------30--------40--------50
TGGCTCAGGCAAACAGAGACT
Termini: H, OH
Average Mass (Da): 6464.3
Monoisotopic Mass (Da): 6461.1

Target Mass Summary

RT (min)	Target Mass, Avg (Da)	Observed Mass (Da)	Mass Error	Intensity	Result Code
0.32	6464.3	6464.3	0.0 Da (0.000 %)	3.60E+005

Chromatogram Summary

RT (min)	Base Peak Mass (Da)	Intensity	Spectral Quality
0.32	6464.3	3.60E+005	ok

[<<] [Top] [LC/UV 260 nm]
LC/MS Chromatogram of test oligo 07:
TIC

[<<] [Top] [LC/MS]
LC/UV 260 nm Chromatogram of test oligo 07:
LC/Analog Chromatogram

[<<] [Top] [Deconvolution] [Zoom Deconvolution] [Deconvolution Peak Report] [Log File]
ESI Mass Spectrum of test oligo 07, RT = 0.32 min:
Scan Mode: - c ESI Q3MS [ 550.00-1400.00]
Scans Averaged: 7 8 9 10 11 12 13 14 15 16
ESI spectrum, RT=0.32

[<<] [Top] [ESI Mass Spectrum] [Zoom Deconvolution] [Deconvolution Peak Report] [Log File]
Deconvoluted Mass Spectrum of test oligo 07, RT = 0.32 min:
Decon spectrum, RT=0.32

[<<] [Top] [ESI Mass Spectrum] [Deconvolution] [Deconvolution Peak Report] [Log File]
Zoom Deconvoluted Mass Spectrum of test oligo 07, RT = 0.32 min:
Zoom spectrum, RT=0.32

[<<] [Top]

Result Code	Indication
	Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance
	Target mass found as the most abundant in one of the chromatographic peaks, but NOT as most abundant component in chromatogram
	Target mass found in chromatogram with either or all of the following: (a) other components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score)
	Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks
	Target mass NOT found in chromatogram within 0.02% mass error tolerance
	No target masses specified