|
Data File: C:\Xcalibur\data\Oligo-TSQ-LCQ\test120merTSQ.raw Comments: TSQ data on 120mer Sample Name: 10 uM x 10 uL Sample ID: test120mer TSQ Nucleotide: 1--------10--------20--------30--------40--------50 CGTAATACGACTCACTATAGGTGTACCCCATTAATTTGGGATGCCAAAGT CATTTGATGCTGACCTCCACTGGGTGGATTAAGGTCAAGGTATGAAGTCC TATTCGCTCCTGATAGGATC Termini: H, OH Average Mass (Da): 37031.0 Monoisotopic Mass (Da): 37013.1 |
|
| RT (min) | Target Mass, Avg (Da) | Observed Mass (Da) | Mass Error | Intensity |
%Total Abundance |
Result Code |
|---|---|---|---|---|---|---|
| 1.57 | 37031.0 | 37030.1 | -0.9 Da (-0.002 %) | 2.11E+006 | 67.5 |
| RT (min) | Base Peak Mass (Da) | Intensity | Spectral Quality |
|---|---|---|---|
| 1.57 | 37030.1 | 2.11E+006 | ok |
[<<]
[Top]
[LC/UV 260 nm]
LC/MS Chromatogram of test120mer TSQ:
TIC

[<<]
[Top]
[LC/MS]
LC/UV 260 nm Chromatogram of test120mer TSQ:

[<<]
[Top]
[Deconvolution]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[Log File]
ESI Mass Spectrum of test120mer TSQ, RT = 1.57 min:
Scan Mode: - p ESI Q3MS [ 550.00-1500.00]
Scans Averaged: 28 - 36

[<<]
[Top]
[ESI Mass Spectrum]
[Zoom Deconvolution]
[Deconvolution Peak Report]
[Raw Data]
[Log File]
Deconvoluted Mass Spectrum of test120mer TSQ, RT = 1.57 min:

[<<]
[Top]
[ESI Mass Spectrum]
[Deconvolution]
[Deconvolution Peak Report]
[Raw Data]
[Log File]
Zoom Deconvoluted Mass Spectrum of test120mer TSQ, RT = 1.57 min:

| Result Code | Indication |
|---|---|
| Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance | |
| Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram | |
| Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score) | |
| Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks | |
| Target mass NOT found in chromatogram within 0.02% mass error tolerance | |
| No target masses specified |