[<<]
Data File: C:\Xcalibur\data\Oligo-TSQ-LCQ\test120merTSQ10pm.raw
Comments: TSQ data on 120mer - 10 pmoles
Sample Name: 1 uM x 10 uL
Sample ID: test120mer TSQ 10 pm
Nucleotide:
1--------10--------20--------30--------40--------50
CGTAATACGACTCACTATAGGTGTACCCCATTAATTTGGGATGCCAAAGT
CATTTGATGCTGACCTCCACTGGGTGGATTAAGGTCAAGGTATGAAGTCC
TATTCGCTCCTGATAGGATC

Termini: H, OH
Average Mass (Da): 37031.0
Monoisotopic Mass (Da): 37013.1
logo


Target Mass Summary

RT (min) Target Mass, Avg (Da) Observed Mass (Da) Mass Error Intensity %Total
Abundance
Result Code
1.57 37031.0 37032.2 1.2 Da (0.003 %) 8.83E+005 48.5  

Chromatogram Summary

RT (min) Base Peak Mass (Da) Intensity Spectral Quality
1.57 37032.2 8.83E+005 ok


[<<]   [Top]   [LC/UV 260 nm]
LC/MS Chromatogram of test120mer TSQ 10 pm:
TIC
LC/MS Chromatogram


[<<]   [Top]   [LC/MS]
LC/UV 260 nm Chromatogram of test120mer TSQ 10 pm:
LC/Analog Chromatogram


[<<]   [Top]   [Deconvolution]   [Zoom Deconvolution]   [Deconvolution Peak Report]   [Log File]
ESI Mass Spectrum of test120mer TSQ 10 pm, RT = 1.57 min:
Scan Mode: - p ESI Q3MS [ 550.00-1500.00]
Scans Averaged: 29 - 36

ESI spectrum, RT=1.57


[<<]   [Top]   [ESI Mass Spectrum]   [Zoom Deconvolution]   [Deconvolution Peak Report]   [Raw Data]   [Log File]
Deconvoluted Mass Spectrum of test120mer TSQ 10 pm, RT = 1.57 min:
Decon spectrum, RT=1.57


[<<]   [Top]   [ESI Mass Spectrum]   [Deconvolution]   [Deconvolution Peak Report]   [Raw Data]   [Log File]
Zoom Deconvoluted Mass Spectrum of test120mer TSQ 10 pm, RT = 1.57 min:
Zoom spectrum, RT=1.57


[<<]   [Top]

Result Code Indication
  Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance
  Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram
  Target mass found in chromatogram with either or all of the following:
(a) other non-target components present in spectrum > 30% relative abundance
(b) low spectral quality (low intensity and/or score)
  Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks
  Target mass NOT found in chromatogram within 0.02% mass error tolerance
  No target masses specified



ZNova 2.0.1 ©2004 Novatia, LLC