test80merTSQ.html

[<<]

Data File: C:\Xcalibur\data\Oligo-TSQ-LCQ\test80merTSQ.raw
Comments: TSQ data on 80mer
Sample Name: 10 uM x 10 uL
Sample ID: test80mer TSQ
Nucleotide:
1--------10--------20--------30--------40--------50
CGCCGTTTTTCTAAAACTTGCGATACCTCGAGAGGGTAGTAAAATTAGAA
TCAACAAACAGAATTCGAGCTCGTTTAAAC
Termini: H, OH
Average Mass (Da): 24661.1
Monoisotopic Mass (Da): 24649.2

Target Mass Summary

RT (min)	Target Mass, Avg (Da)	Observed Mass (Da)	Mass Error	Intensity	%Total Abundance	Result Code
1.52	24661.1	24658.9	-2.2 Da (-0.009 %)	5.50E+006	96.7

Chromatogram Summary

RT (min)	Base Peak Mass (Da)	Intensity	Spectral Quality
1.52	24658.9	5.50E+006	ok

[<<] [Top] [LC/UV 260 nm]
LC/MS Chromatogram of test80mer TSQ:
TIC

[<<] [Top] [LC/MS]
LC/UV 260 nm Chromatogram of test80mer TSQ:
LC/Analog Chromatogram

[<<] [Top] [Deconvolution] [Zoom Deconvolution] [Deconvolution Peak Report] [Log File]
ESI Mass Spectrum of test80mer TSQ, RT = 1.52 min:
Scan Mode: - p ESI Q3MS [ 550.00-1500.00]
Scans Averaged: 27 - 35
ESI spectrum, RT=1.52

[<<] [Top] [ESI Mass Spectrum] [Zoom Deconvolution] [Deconvolution Peak Report] [Raw Data] [Log File]
Deconvoluted Mass Spectrum of test80mer TSQ, RT = 1.52 min:
Decon spectrum, RT=1.52

[<<] [Top] [ESI Mass Spectrum] [Deconvolution] [Deconvolution Peak Report] [Raw Data] [Log File]
Zoom Deconvoluted Mass Spectrum of test80mer TSQ, RT = 1.52 min:
Zoom spectrum, RT=1.52

[<<] [Top]

Result Code Indication

Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance

Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram

Target mass found in chromatogram with either or all of the following:
(a) other non-target components present in spectrum > 30% relative abundance
(b) low spectral quality (low intensity and/or score)

Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks

Target mass NOT found in chromatogram within 0.02% mass error tolerance

No target masses specified

Result Code	Indication
	Target mass found in chromatogram as the most abundant component within 0.02% mass error tolerance
	Target mass found as a major component or as a minor component with other target masses, but NOT as most abundant component in chromatogram
	Target mass found in chromatogram with either or all of the following: (a) other non-target components present in spectrum > 30% relative abundance (b) low spectral quality (low intensity and/or score)
	Target mass found in chromatogram, but NOT as the most abundant in any of the chromatographic peaks
	Target mass NOT found in chromatogram within 0.02% mass error tolerance
	No target masses specified